Vela P.1, Salinero C.1, Sainz M.J.2, González M.1, Couselo J.L.1 , Spain
1 Estación Fitopatolóxica do Areeiro, Deputación de Pontevedra. Subida a la Robleda, s/n. 36153 Pontevedra, Spain. efa@efa-dip.org
2 Departamento de Producción Vegetal, Universidad de Santiago de Compostela. Campus Universitario s/n, 27002 Lugo, Spain.
In the gardens around the world grow old specimens of different camellia cultivars, which are part of the cultural heritage of each country and an important reservoir of germplasm. Many of these cultivars were originated in Asia over 400 years ago or in Western countries during the nineteenth century.
The exact date of introduction of camellia plants to Western countries is not known, as the existing documentation on the subject is scarce and confusing. Thousands of camellia cultivars were extensively cultivated in Europe during the nineteenth century but camellia plants were moved from one country to another without any control and often with the wrong name. Many nurseries involved in producing camellia plants from rooted cuttings or seeds gave different names to cultivars whose variations were insignificant and unstable. In addition, some cultivars were designated differently depending on the place they were grown, increasing the confusion that already existed in the nomenclature.
During the first half of the twentieth century, the interest in camellias decreased, with many of them abandoned in the gardens. However, some of these neglected camellias survived until today, losing in most cases their original names and part of their history.
Nowadays the International Camellia Register (ICR) comprises over 32,000 camellia cultivars -mostly belonging to Camellia japonica - a number that is increasing each year with the introduction of new cultivars. The ICR includes all the cultivars for which there is any written reference or description of the flower and in some cases the plant, but without checking if a particular cultivar is already registered under a different name. Moreover, many of the camellia descriptions gathered by the ICR are brief, inaccurate and insufficient. Thus, the actual number of existing cultivars could be lower than those compiled by the ICR.
In order to know the real number of cultivars included within each species, duplicated and wrongly identified cultivars within the ICR should be detected. The key issue could be the establishment of reference camellia cultivars from the characterization of cultivars originated in the nineteenth century and earlier, whose names were lost during the twentieth century. The study of these old cultivars should consider the historical, cultural and botanical background.
First works on the study of old camellias began in the late years of the twentieth century mainly in Belgium, Italy, Portugal and Spain. Some old camellia plants from these countries were characterized by comparing their morphological features with information available at the ICR, in nursery catalogs, in drawings included in nineteenth century publications, and when possible with well-identified plants maintained in living collections. Morphological analysis is the traditional and most used tool for the identification of camellia species and cultivars. It is based on agromorphological traits of the flower and the leaf, bush size, disease resistance, cold hardiness, etc., but these descriptors can be influenced by ontogenic and environmental factors that may alter the size, colour and even the shape of the flower, masking the real genetic diversity (Banerjee, 1992; Trehane, 2007). Furthermore, some morphological features, especially those of flowers, are highly variable among individuals belonging to the same cultivar and even among flowers of the same plant, hindering their visual assessment by researchers. For this reason, the identification of camellia cultivars which relies only on the analysis of morphobotanical characters is insufficient, particularly for those of Camellia japonica
Molecular techniques based on DNA analysis have proven useful for the characterization of plant material in a number of wild and cultivated species (Mohan et al., 1997; Ouborg et al., 1999). In particular, microsatellites were the most useful and reliable molecular markers for cultivar identification in many plants.
Over 50 microsatellite loci in the genomic DNA of Camellia sinensis have been described and successfully used for the study of tea plant material (Kaundun and Matsumoto, 2002, 2004; Freeman et al., 2004; Hung et al., 2008; Zhao et al., 2008). Some of these microsatellites are also present in the genomic DNA of C. japonica, and could be effective for the characterization of cultivars of this species, as an additional tool to the classical identification based on morphological characters.
The aim of the present work was to find and characterize, by using morphological and molecular techniques, old plants of Camellia japonica growing in public and private gardens in Spain and other European countries, as the basis for the establishment of a germplasm bank of C. japonica reference cultivars.
Camellia plant material was obtained from 31 old individuals from Germany, Italy, Portugal and Spain, and from 18 plants of different cultivars maintained at two locations (Areeiro and Soutomaior) belonging to the Spanish living camellia germplasm collection of Deputación de Pontevedra (Table 1).
A survey to search for old plants with recognizable features of known 19th century camellia cultivars was carried out in Galician (NW Spain) and North Portugal gardens. Seventeen plants (15 in Spain and 2 in Portugal) belonging to different old cultivars were found.
Another old camellia cultivar belonged to the botanical collection of Palmengarten (Frankfurt, Germany). The remaining 13 old individuals were part of Villa Annelli garden collection (Oggebbio, Italy).
Plants belonging to the Spanish living camellia germplasm collection were established from commercial nursery plant material between 1985 and 1989.
Table 1. Camellia japonica cultivars of the field germplasm bank with data on origin, location and first known written reference.
|
CULTIVAR |
Origin |
First written reference |
LOCATION |
|
|
Akashigata |
Japan |
1859 |
Castillo de Soutomaior |
Spain |
|
Alba Plena |
China |
1797 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Anemoniflora (Waratah) |
China |
1806 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Angela Cocchi |
Italy |
1856 |
Villa Anelli |
Italy |
|
Antonio Bernardo Ferreira |
Portugal |
1883 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Baronne Leguay |
France |
1873 |
Castillo de Soutomaior |
Spain |
|
Bella Lambertii |
Italy |
1851 |
Castillo de Soutomaior |
Spain |
|
Bella Portuense |
Portugal |
1865 |
E. F. do Areeiro |
Spain |
|
Bella Romana |
Italy |
1856 |
Pazo de Lourizan |
Spain |
|
Compacta Alba |
France |
1839 |
Castillo de Soutomaior |
Spain |
|
Daikagura (Ortigueira) |
Japan |
1788 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Daviesii |
UK |
1843 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Doutor Balthazar de Mello |
Portugal |
1891 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Eugenia de Montijo |
Spain |
1897 |
Castillo de Soutomaior |
Spain |
|
Federicci |
Italy |
1849 |
Jardim Botanico de Porto |
Portugal |
|
Gigantea |
UK |
1830 |
Pazo de Torres Agrelo |
Spain |
|
Gran Sultan |
Italy |
1841 |
Villa Anelli |
Italy |
|
Grandiflora Superba |
France |
1840 |
Castillo de Soutomaior |
Spain |
|
Hagoromo |
Japan |
1695 |
E. F. do Areeiro |
Spain |
|
Hikarugenji |
Japan |
1859 |
E. F. do Areeiro |
Spain |
|
Il Cigno |
Italy |
1845 |
E. F. do Areeiro |
Spain |
|
Il Giogello |
Italy |
1867 |
E. F. do Areeiro |
Spain |
|
Imbricata |
China |
1824 |
E. F. do Areeiro |
Spain |
|
Incarnata |
China |
1812 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Justine Heurtin |
France |
1886 |
Castillo de Soutomaior |
Spain |
|
Latifolia |
Belgium |
1834 |
Pazo de La Saleta |
Spain |
|
Leeana Superba |
Belgium |
1834 |
Villa Anelli |
Italy |
|
Leonardo da Vinci |
Italy |
1888 |
Castillo de Soutomaior |
Spain |
|
Margherita Coleoni |
Belgium |
1865 |
E. F. do Areeiro |
Spain |
|
Marguerite Gouillon |
France |
1839 |
Pazo de Quintáns |
Spain |
|
Mathotiana |
Belgium |
1847 |
Villa Anelli |
Italy |
|
Mathotiana Alba |
Belgium |
1858 |
Villa Anelli |
Italy |
|
Mathotiana Rosea |
UK |
1874 |
Villa Anelli |
Italy |
|
Mont Blanc |
Belgium |
1843 |
Pazo de Santa Cruz de Ribadulla |
Spain |
|
Nobilissima |
Belgium |
1836 |
E. F. do Areeiro |
Spain |
|
Pompone |
China |
1815 |
Jardim Botanico de Porto |
Portugal |
|
Prince Eugene Napoleon |
Belgium |
1859 |
Pazo de Gandarón |
Spain |
|
Princesse Baciocchi |
Italy |
1842 |
E. F. do Areeiro |
Spain |
|
Roma Risorta |
Italy |
1866 |
Villa Anelli |
Italy |
|
Rubescens Major |
France |
1886 |
Pazo de La Saleta |
Spain |
|
Sacco |
Italy |
1839 |
Villa Anelli |
Italy |
|
Shiragiku (White Chrysanthemum) |
Japan |
1681 |
Pazo de La Saleta |
Spain |
|
Teutonia |
Germany |
1843 |
Palmengarten |
Germany |
|
Toki-no-hagasane |
Japan |
1879 |
E. F. do Areeiro |
Spain |
|
Tricolor |
Japan |
1829 |
Villa Anelli |
Italy |
|
Variegata |
China |
1792 |
Villa Anelli |
Italy |
|
Vergine di Collebeato |
Italy |
1846 |
Villa Anelli |
Italy |
|
Virginia Franco |
Italy |
1858 |
Villa Anelli |
Italy |
|
Vittorio Emanuelle II |
Italy |
1861 |
Villa Anelli |
Italy |
For the morphological characterization of the 17 old Spanish and Portuguese cultivars and the 18 cultivars of the Spanish living camellia germplasm collection, samples of flower, leaf and fruit (when available) were taken. Thirty-six morphobotanic descriptors were used: growth habit; in leaves: length, width, leaf area index, petiole length, blade shape, apex shape, base shape, margin and lamina color; in flowers: shape and diameter; in petals: number, form, margin, color, color distribution and venation; in petaloids: presence or absence, number, arrangement and variegation; in stamens: presence or absence, number, arrangement, filament color, anther color, union anther-filament, anther dehiscence, relative height androecium-gynoecium; and in fruits: presence or absence, number, texture and seed shape.
The 49 cultivars were characterized by microsatellite markers. Genomic DNA was extracted from frozen leaf samples by the EZNA High Performance Plant DNA Kit (Omega Biotek), according to the standard protocol recommended by the manufacturer. The DNA template of each sample was amplified with fourteen microsatellite markers, 7 proposed for 7 loci of the genomic DNA of C. japonica (Ueno et al., 1999, Abe et al., 2006) and other 7 for the genomic DNA of C. sinensis (Freeman et al., 2004; Hung et al., 2008; Zhao et al., 2008).
Following the method of Schuelke (2000), the forward primer of each microsatellite was labeled with one of the following fluorescent labels (fluorophores): 6-FAM, NED, PET and VIC (Applied Biosystems). The name, repeating pattern, sequences of forward and reverse primers and amplification conditions (temperature and annealing cycle time) of microsatellites are presented in
Table 2. Characteristics of the 14 microsatellite loci of Camellia japonica and Camellia sinensis, showing the repeat motif, sequences of each primer, annealing temperature, annealing cycle time, and expected allele size.
|
Micro satellites |
Repeat motif |
Primer sequences (5’→3’) |
Tm (oC) |
Cycle time |
Size expected (pb) |
|
MSCjaF25 |
(CA)8(AAAAAT)4 |
F:GGGAAGGTGCATAAAATACT R:TGCGACCTAAGATTACTAAA |
58 |
1 min |
213-245 |
|
MSCjaF37 |
(AG)13(GAA)7 |
F:CGCTCGACGTAATGCCACACT R:CGAGCCTTCCTTTTCCCATTC |
58 |
1 min |
344-370 |
|
MSCjaH38 |
(GA)14 |
F:CCTATTGCCTACGACCATTTC R:GCTGAGCTTGGAGATTTTGTT |
55 |
1 min |
343-362 |
|
MSCjaH46 |
(GA)16 |
F:AGGGAGCATTATGAGTCGTCT R:CATCGTCCTAATCCACTTCAC |
55 |
1 min |
443-461 |
|
MSCjaQ11 |
(GA)13 |
F:GCCTCCGATGCATTGGT R: CCACTATTTTGTTCCCTTGC |
60 |
1 min |
200-224 |
|
MSCjaR02 |
(CT)8...(CT)11 |
F:AAGGGTGATGCAAAAGTGAGA R: TTCTTTGGGTTGTGTTCCAA |
55 |
1 min |
219-248 |
|
MSCjaT25 |
(GA)4...(GA)18 |
F: CACAGTCTTCAAAACAACTT R: AGGACCTCACCCTTGTTGA |
55 |
1 min |
172-193 |
|
CamsinM5 |
(GT)15(GA)8 |
F:AAACTTCAACAACCAGCTCTGGTA R:AATTATAGGATGCAAACAGGCATGA |
60 |
1 min |
206-224 |
|
CamsinM11 |
(CA)12 |
F:GCATCATTCCACCACTCACC R:GTCATCAAACCAGTGGCTCA |
55 |
1 min |
173-182 |
|
Ca01 |
(CAG)6…(CAG)5 |
F:CCCAGCAAAACCCCAGCATG R:CTTCCGAACTGCAGGTTGTGG |
64/ 60 |
1 min |
157-176 |
|
Ca06 |
(GT)12(GA)10 |
F:CATGTAGAATGCTCAAATGC R:ACCTGAAAACGATCCTGACAT |
60 |
30 seg |
237-362 |
|
Ca08 |
(CT)10 |
F:TTCAATTACCCGCCAATCTC R:CCAATCTGGGAATTGAAGAAG |
55 |
1 min |
154-187 |
|
Z496 |
(AG)11 |
F:GAAAGTGCGAAACCAAAC R:CTGCGAACCCTCTTGACC |
55 |
1 min |
102-122 |
|
Z641 |
(AGAGA)3 |
F:CAAGCAATACATACACACA R:AACAGAGCATACCCAGAAG |
60 |
30 seg |
149-209 |
Amplification reactions by PCR were carried out in a final volume of 25 mL containing: 50 ng of genomic DNA, 0.08 mM of each primer, 1U Taq polymerase and 0.2 mM of each dNTP. PCR reactions were performed in a thermocycler Doppio (VWR). Amplification conditions were: 5 minutes at 95°C, 35 cycles: 1 minute at 95°C, between 30 seconds and one minute at the corresponding hybridization temperature (Tm) (temperature and hybridization cycle time for each microsatellite are shown in Table 2), 1 minute at 72°C, and a final step of 15 minutes at 72°C.
Stem cuttings from the 49 cultivars were used to propagate new plants that were then planted to initiate the first field germplasm bank of camellia reference cultivars at the Estación Fitopatolóxica do Areeiro (Pontevedra, NW Spain).
The morphological descriptors were useful tools for differentiating most of the Camellia japonica cultivars of the study (data not shown). However, some of them (like ‘Imbricata’ and ‘Princesse
![]() |
![]() |
Baciocchi’, figures 1 and 2) share very similar flower features, being almost impossible to be properly identified from morphological characters. In addition, many of the cultivars of the study are indistinguisable from others of the more than 30,000 registered.
Our results show that the identification of an unknown cultivar of C. japonica can not always be achieved by making a comparison of the key descriptors of the morphological characteristics with known cultivar descriptions. It is therefore essential to use other techniques to complement the morphological characterization. The 14 microsatellite markers proved to be efficient for the differentiation of C. japonica cultivars, as they provide characteristic allelic profiles for each cultivar (data not shown). Allelic profiles were used as the main basis for the characterization and establishment of the first germplasm bank of camellia reference cultivars.
The application of microsatellite markers for producing robust and reliable cultivar descriptions, suitable for database use and largely unaffected by environment, can be a key tool to achieve distinctness from the large numbers of cultivars that could make up the reference collection of Camellia japonica cultivars in the future.
This work was funded by Xunta de Galicia (Project PGIDIT06RAG26103PR).
We thank Dr. Clemens Bayer and Dr. Andrea Corneo for sending us camellia samples.
References
Banerjee B. 1992. Selection and breeding of tea. In ‘Tea: cultivation to consumption’, Eds. K.C. Wilson & M.N. Clifford. Chapman and Hall, London. pp. 53-85.
Berlèse L. 1843. Iconographie du genre Camellia ou description et figures des camellias les plus beaux et les plus rares. Tome III. H. Cousin, Paris, Francia.
Freeman S., West J., James C., Lea V., Mayess S. 2004 Isolation and characterization of highly polymorphic microsatellites in tea (Camellia sinensis). Molecular Ecolgy Notes 4: 324-326.
Chandler A., Booth B. Illustrations and descriptions of the plants which compose the natural order Camellieae, and of the varieties of Camellia japonica, cultivated in the gardens of Great Britain. C. Baynes, London, Reino Unido.
Hung C.Y., Wang K.H., Huang C.C., Gong X., Ge X.J., Chiang T.Y. 2008. Isolation and characterization of 11 microsatellite loci from Camellia sinensis in Taiwan using PCR-based isolation of microsatellite arrays (PIMA). Conservation Genetics 9: 779-781.
Kaundun S.S., Matsumoto S. 2002. Heterologous nuclear and chloroplast microsatellite amplification and variation in tea, Camellia sinensis. Genome 45: 1041-1048.
Kaundun S.S., Matsumoto S. 2004. PCR-based amplicon length polymorphisms (ALPs) at microsatellite loci and indels from non-coding DNA regions of cloned genes as a means of authenticating comercial Japanese green teas. Journal of the Science of Food and Agriculture 84: 895-902.
Mohan M., Nair S., Bhagwat A., Krishna T.G., Yano M., Bhatia C.R., Sasaki T. 1997. Genome mapping, molecular markers and markers assisted selection in crop plants. Molecular Breeding 3: 87-103.
Ouborg N.J., Piquot Y., van Groenendael M. 1999. Population genetics, molecular markers and the study of dispersal in plants. Journal of Ecology 87: 551-568.
Trehane J. 2007. Camellias: the gardener’s encyclopedia. Timber Press, Inc. Portland, Oregon, USA.
Zhao L.P., Liu Z., Chen E.L., Yao E.M.Z., Wang E.X.C. 2008. Generation and characterization of 24 novel EST derived microsatellites from tea plant (Camellia sinensis) and cross-species amplification in its closely related species and varieties. Conservation Genetics 9: 1327–1331.