Vela P., Couselo J.L., Salinero C., Paz C.
Estación Fitopatolóxica de Areeiro, Deputación de Pontevedra, Subida á Carballeira, s/n, 36153 Pontevedra, Spain. E-mail: pilar.vela@depo.es
The genus Camellia is native to Eastern Asia, where its species have been widely cultivated for centuries. The exact date of arrival of the first live plants of this genus in Europe is unknown and, although they might have arrived before the 18th century, there is not written documentation that proves this hypothesis. The first documented living camellia plants were exhibited in Essex, England, in 1739, and some nurseries in London already had camellias for sale in their catalogues in the last quarter of the 18th century.
The first camellia plants designated with a name, namely ‘Alba Plena’ and ‘Variegata’, arrived in the United Kingdom from China in 1792. In subsequent years many Camellia japonica cultivars arrived in Kew, London.
The cultivar ‘Pompone’ was introduced in Kew Gardens in 1810 (Savige, 1993) and rapidly disseminated in Europe. The International Camellia Register (ICR) describes this cultivar as having varied flowers, large, with two rows of petal and a central bunch of white petaloids, sometimes pink, and sometimes variegated in white and pink, sometimes even growing in the same branch. It was designated with other names, such as ‘Mutabilis’, ‘Pomponia’ or ‘Variabilis’ (Savige, 1993).
In historic gardens and in the Galician pazos there are several camellia plants, some of them several centuries old that may belong to this cultivar, since their flowers match the description of the ICR (Figures 1 and 2). However, the lack of documentation on these plants hinders their correct identification.
Figure 1. Hundred year-old plant growing at the Pazo Quiñones de León (Vigo, Spain),
identified as Camellia japonica 'Pompone'
The characterization of the plant material has been traditionally based on the study of different morphological characteristics of the flower and the leaf, plant habit, cold hardiness and disease susceptibility, among others. For many plant species, both wild and cultivated, the use of morphobotanic descriptors has been efficient for the management and preservation of these collections. Given the largest diversity of cultivars and their difficult characterization, especially in the case of old cultivars, it is crucial to establish specific descriptors that enable the characterization of this Camellia japonica germplasm. These descriptors were described and used in previous works (Vela et al, 2009; Salinero et al, 2012).
Figure 2. Flowers of a Camellia japonica
specimen identifies as 'Pompone'
Some Camellia cultivars have highly variable morphobotanic characteristics, found even in the flowers of the same plant, thus the use of these descriptors is not enough for camellia cultivar differentiation.
Molecular techniques based on DNA analysis have proven useful for the characterization of plant material in a number of wild and cultivated species (Mohan et al., 1997; Ouborg et al., 1999). As regards Camellia, most molecular studies have been focused on C. sinensis, the tea plant, because this is the species of camellia with the highest economical value.
Among the molecular markers, microsatellites proved to be the most useful and reliable for cultivar identification in many wild and cultivated species, among them ornamentals (Esselink et al., 2003; Caser et al., 2010). Microsatellite markers are codominant, polymorphic, highly reproducible, independent of the environment and provide information on the genetic material of the plant that remains unchanged and identical in each cultivar (Mohan et al., 1997; Esselink et al., 2003).
Over 50 microsatellite loci in the genomic DNA of Camellia sinensis have been described and successfully used for the study of tea plant material (Kaundun and Matsumoto, 2002, 2004; Freeman et al., 2004; Hung et al., 2008; Zhao et al., 2008). Microsatellite loci useful for the identification of Camellia japonica cultivars have also been found (Ueno et al., 1999; Abe et al., 2006). Some microsatellites described for C. sinensis are also present in the genomic DNA of other Camellia species such as C. japonica subsp. rusticana, C. japonica and C. sasanqua (Ueno et al., 1999), or C. taliensis, C. tachangensis and C. gymnogyna (Zhao et al., 2008), thus they could be effective for the study of the genetic diversity of Camellia japonica as an additional tool to the classical identification based on morphological characters.
The aim of the present work is to characterize, by using morphobotanic descriptors and molecular markers, old specimens of Camellia japonica similar to the cultivar ‘Pompone’ growing in historical gardens in Galicia.
Plant material of 30 Camellia japonica specimens growing in five historic gardens in Galicia (NW Spain) was collected. The specimens were collected on the basis of the similarities found with the description of the ICR for the ‘Pompone’ cultivar. The table 1 shows the code and location of these plants.
Table 1. Codes and name of the garden of the 30 camellia plants selected
|
Plant code |
Garden |
Location |
|
PL-12, PL-23, P L-35, PL-54, PL-55, PL-58 |
Pazo de Lourizán |
Pontevedra |
|
O-02, O-04, O-13, O-15, O-16, O-20, O-22, O-23, O-25, O-40, O-41, O-43, O-47, O-51, O-52, O-53, O-54, O60, O-61, O-64 |
Pazo de Oca |
A Estrada |
|
PQL-01 |
Pazo Quiñones de León |
Vigo |
|
SCR-02, SCR-19, SCR-21 |
Pazo de Santa Cruz de Rivadulla |
Vedra |
From 2010 to 2013, samples of leaf and flower of the 30 plants were collected. 10 adult leaves and 10 well-formed flowers were collected. Of the plants with flowers of different colours, 10 flowers of each colour were taken per plant. For the morphobotanic characterization of this material, 29 descriptors of plant, leaf and flower described for C. japonica by Vela et al. (2009) and Salinero et al. (2012) were used. The descriptors applied were:
Plant: growth habit and foliage; beginning and length of the blooming period, and flower drop (completely or loose petals).
Leaf: length and width, blade shape, apex, margin and base form.
Flower: shape, diameter and depth. Number of petals, shape of internal and external petals, margin, colour and colour pattern; amount, arrangement, colour and colour pattern of petaloids; amount, arrangement and filament colour of stamens; and presence or absence of style and division.
For the genotyping, in each plant, DNA was isolated from 100 mg of leaves with NucleoSpin® Plant II DNA Kit according to the manufacturer protocol (Macherey-Nagel). A set of eight polymorphic DNA microsatellites sequences developed in C. japonica (Ueno et al., 1999; Abe et al., 2006) and C. sinensis (Freeman et al., 2004; Zhao et al., 2008) was tested (Figure 3). DNA fragments were amplified using the tailed primer method (Schuelke, 2000). The reactions were performed in 25 µL total volume containing 50 ng of genomic DNA. PCR parameters were as follows: 5 min at 95ºC, 35 cycles for 1min at 95ºC, 45s of annealing with corresponding Tm (Table 2), 1 min at 72ºC and a final step of 15min at 72ºC.
Table 2. Characteristics of the 8 microsatellite loci of Camellia japonica and C. sinensis, showing the repeat motif, sequences of each primer, annealing temperature, annealing cycle time, and expected allele size.
| Micro satellites |
Repeat motif |
Primer sequences (5’→3’) |
Tm (oC) |
Cycle time |
Size expected (pb) |
| MSCjaF25 | (CA)8(AAAAAT)4 | F:GGGAAGGTGCATAAAATACT R:TGCGACCTAAGATTACTAAA |
58 | 1 min | 213-245 |
| MSCjaF37 | (AG)13(GAA)7 | F:CGCTCGACGTAATGCCACACT R:CGAGCCTTCCTTTTCCCATTC |
58 | 1 min | 344-370 |
| MSCjaH38 | (GA)14 | F:CCTATTGCCTACGACCATTTC R:GCTGAGCTTGGAGATTTTGTT |
55 | 1 min | 343-362 |
| MSCjaH46 | (GA)16 | F:AGGGAGCATTATGAGTCGTCT R:CATCGTCCTAATCCACTTCAC |
55 | 1 min | 443-461 |
| MSCjaR02 | (CT)8...(CT)11 | F:AAGGGTGATGCAAAAGTGAGA R: TTCTTTGGGTTGTGTTCCAA |
55 | 1 min | 219-248 |
| CamsinM5 | (GT)15(GA)8 | F:AAACTTCAACAACCAGCTCTGGTA R:AATTATAGGATGCAAACAGGCATGA |
60 | 1 min | 206-224 |
| CamsinM11 | (CA)12 | F:GCATCATTCCACCACTCACC R:GTCATCAAACCAGTGGCTCA |
55 | 1 min | 173-182 |
| Z496 | (AG)11 | F:GAAAGTGCGAAACCAAAC R:CTGCGAACCCTCTTGACC |
55 | 1 min | 102-122 |
The fluorescent dye labels used were 6-FAM, NED, PET and VIC (Applied Biosystems). A volume of 1 µL of amplification products were added to 15 µL of formamide and 0.3 µL of Genescan 500 LIZ size standard. Mixed solution was denatured at 95ºC for 3 min. The samples were run on ABI PRISM 310 Genetic Analyzer (Applied Biosystems). Allele scoring was performed using the Genemapper 4.0 software (Applied Biosystems).
The morphobotanic descriptors of the plant (growth habit, foliage) and blooming period (beginning, length and flower fall) were identical for all cultivars (data not shown).
All plants showed highly similar characteristics of the leaf, although the length and width of the blade were different among plants (figure 5). No differences were observed on the base shape that was acute in all of them. Most plants showed a elliptic leaf, or from elliptic to ovate, except one of them, PL-54, whose blade was lanceolate. As regards its margin, PQL-01 was the only one with a serrate margin, as compared to the rest, having a denticulate or finely dentate margin. The apex ranged from pointed to acuminate in different plants and also in the leaves of a single plant (Table 3).
As regards the flowers, the main differences were observed in petal colour and colour pattern. Some plants had flowers with one, two and three colours, and even there was a specimen with flowers of four colours in the Pazo de Oca (O-15). Colours ranged from uniform pink to uniform white to white with pink dots and stripes, pink with white spots and/or pink with a white margin (Table 4).
The shape of the flower, as well as its diameter and depth was different in the flowers of a same plant and of the same colour (Table 4).
Although the number of petaloids and stamens was widely different among flowers, even in the same plant, no important differences were observed in the qualitative characteristics of petaloids, stamens and style. Petaloids were split and stamens were dispersed in all cultivars. The colour and distribution of petaloids ranged from white to pink, and homogenous or streaked; and only one single plant (SCR-21) had filaments of a reddish colour, whereas the rest were white or yellowish white. This characteristic was enough to consider this specimen as a different cultivar. The style was deformed in all plants, except in PQL-1, with a rudimentary style, thus it was regarded as a different cultivar (Table 5).
The specimens were grouped according to their morphobotanical features in eight groups or cultivars, with nine, six, five, four, two, two, one and one plants, respectively in each of them (Table 6).
The results obtained from the morphological analysis differed from those of the molecular analysis with ISSR. In the latter, eleven groups were obtained according to their allelic profiles (Table 7). Each of these groups corresponded to a single cultivar. The first cultivar comprises sixteen specimens, the second four, a third two, and the remaining eight cultivars, one specimen each.
The differences observed in the results obtained in both analyses showed that morphobotanic descriptors need to be complemented with molecular markers to differentiate between cultivars.
In addition, it is necessary to determine which of these specimens is the real ‘Pompone’ and establish it as a specimen of reference of this cultivar. Then it could be compared to the rest of the specimens with similar characteristics so as to prove if they are identical.
Table 3. Results of the leaf descriptors used for the Camellia japonica specimens identified as 'Pompone'
| Plant code |
length (cm) |
width (cm) |
form | |||
| blade shape | apex | base | margin | |||
| PQL-01 | 7.5-8.5 | 3.0-3.7 | elliptical | pointed/acuminate | acute | finely dentate |
| SCR-02 | 7.5-10.7 | 4.0-5.4 | elliptical | acuminate | acute | serrate |
| SCR-19 | 8.0-9.5 | 4.2-4.9 | elliptical | acuminate | acute | dentate |
| SCR-21 | 8.8-9.8 | 4.5-5.2 | elliptical | acuminate | acute | dentate |
| O-02 | 7.3-8.7 | 3.5-4.5 | elliptical | acuminate | acute | dentate |
| O-04 | 7.1-9.0 | 3.0-4.5 | elliptical | acuminate | acute | dentate |
| O-13 | 7.8-8.5 | 4.2-4.9 | elliptical | acuminate | acute | dentate |
| O-15 | 6.2-8.2 | 3.0-4.0 | elliptical | acuminate/pointed | acute | dentate |
| O-16 | 7.5-8.5 | 3.6-4.4 | elliptical | acuminate | acute | dentate |
| O-20 | 6.6-8.0 | 3.3-4.2 | elliptical | pointed | acute | dentate |
| O-22 | 7.3-8.9 | 3.9-4.6 | elliptical/ovate | acuminate | acute | dentate |
| O-23 | 10.9 | 7.0-8.5 | elliptical | pointed/acuminate | acute | dentate |
| O-25 | 7.2-9.1 | 3.6-4.7 | elliptical | acuminate | acute | dentate |
| O-40 | 8.0 | 3.9-4.0 | elliptical | pointed | acute | dentate |
| O-41 | 7.2-10.0 | 3.9-5.3 | elliptical | acuminate | acute | finely dentate |
| O-43 | 6.5-9.8 | 3.0-4.8 | elliptical | acuminate | acute | dentate |
| O-47 | 9.0-10.0 | 4.0-5.2 | elliptical | pointed | acute | dentate |
| O-51 | 10-11 | 5.3-6.3 | elliptical | acuminate | acute | dentate |
| O-52 | 7.4-9.2 | 3.8-5.0 | elliptical | pointed | acute | dentate |
| O-53 | 7.5-9.4 | 3.6-4.8 | elliptical | pointed | acute | dentate |
| O-54 | 8.5-10.0 | 3.4-5.4 | elliptical | pointed | acute | dentate |
| O-60 | 7.0-9.3 | 3.6-4.8 | elliptical | pointed | acute | dentate |
| O-61 | 7.0-9.8 | 3.8-5.0 | elliptical | pointed | acute | dentate |
| O-64 | 8.6 | 4.1-5.1 | elliptical | pointed | acute | dentate |
| PL-12 | 7.8-8.9 | 4.6-5.5 | elliptical/ovate | pointed/acuminate | acute | dentate |
| PL-23 | 7.3-8.8 | 3.1-3.9 | elliptical/lanceolate | pointed/acuminate | acute | finely dentate |
| PL-35 | 8.0-9.0 | 4.3-4.7 | elliptical | acuminate | acute | finely dentate |
| PL-54 | 7.3-9.0 | 3.0-3.8 | lanceolate | pointed/acuminate | acute | finely dentate |
| PL-55 | 6.9-9.0 | 3.5-4.6 | elliptical | pointed/acuminate | acute | dentate |
| PL-58 | 7.9-9.5 | 3.3-3.9 | lanceolate/elliptical | acuminate | acute | finely dentate |
Table 4. Results of the flower descriptors (diameter, depth, shape and colour) used in the Camellia japonica specimens identified as 'Pomone'
|
Plant code |
Form |
Diameter (cm) |
Depth (cm) |
Colour |
|
|
colour |
distribution in petals |
||||
|
PQL- 01 |
typical anemone |
8.5-10.0 |
4.0 |
pink |
homogeneous / diffuse towards the base |
|
8.5-10.0 |
4.0 |
white |
homogeneous |
||
|
SCR-02 |
full peony |
7.8-9.5 |
4.1-5.0 |
pink |
homogeneous / diffuse towards the base |
|
7.5-9.5 |
4.0-5.0 |
white - pink |
streaked |
||
|
SCR-19 |
atypical anemone |
7.2-8.5 |
4.3-5.2 |
pink |
homogeneous |
|
7.0-8.2 |
pink - white |
emarginated |
|||
|
SCR-21 |
full peony |
7.7-9.5 |
4.5-5.0 |
pink |
homogeneous / spotted |
|
O-02 |
atypical anemone/ open peony |
7.0-8.5 |
4.2-5.1 |
white - pink |
streaked / spotted |
|
7.2-8.5 |
pink |
homogeneous |
|||
|
O-04 |
atypical anemone/ open peony |
6.5-7.5 |
4.2-5.1 4.3-4.9 4.5-5.0 |
white - pink |
streaked / spotted |
|
6,5-7.4 |
pink |
homogeneous |
|||
|
8.5-10.5 |
white |
homogeneous |
|||
|
O-13 |
atypical anemone/ open peony |
7.0-8.5 |
4.3-5.2 4.5-4.7 4.5-5.2 |
white |
homogeneous |
|
6.2-7.5 |
white - pink |
streaked |
|||
|
7.2-8.8 |
pink |
homogeneous / streaked |
|||
|
O-15 |
atypical anemone |
6.5-8.3 |
4.5-5.1 4.3-4.8 4.5-5.0 4.1-5.2 |
white - pink |
streaked / spotted |
|
6.5 |
pink |
homogeneous |
|||
|
6.1-7.6 |
pink - white |
emarginated |
|||
|
6.0-8.3 |
white |
homogeneous |
|||
|
O-16 |
atypical anemone/ open peony |
7.0-8.8 |
4.7-5.4 |
white - pink 58D |
streaked / spotted |
|
O-20 |
atypical anemone |
6.8-8.6 |
4.6-5.3 |
white - pink |
streaked / spotted |
|
O-22 |
atypical anemone/ open peony |
7.9-9.6 |
4.9-5.5 |
white - pink 65A |
streaked / spotted |
|
7.8-9.3 |
4.8-5.4 |
pink |
homogeneous |
||
|
O-23 |
atypical anemone |
7.5-10 |
4.5-5.2 |
pink |
homogeneous |
|
O-25 |
atypical anemone/ open peony |
7.2-9.3 |
4.2-5.0 |
white - pink |
homogeneous / streaked |
|
O-40 |
atypical anemone |
7.0-8.5 |
4.1-5.2 |
white - pink |
streaked / spotted |
|
O-41 |
atypical anemone |
8.5-10.5 |
4.2-5.1 |
white |
homogeneous |
|
O-43 |
atypical anemone |
6.8-10.0 |
4.3-4.9 |
white - pink |
streaked / spotted |
|
5.5-8.5 |
4.2-5.0 |
pink |
homogeneous |
||
|
O-47 |
atypical anemone |
7.5-8.0 |
4.2-5.1 |
white - pink |
streaked / spotted |
|
8.5-9.0 |
4.1-5.0 |
pink |
homogeneous |
||
|
O-51 |
atypical anemone |
7.9-9.6 |
4.3-5.2 |
white |
homogeneous |
|
8.0-9.5 |
4.1-4.9 |
pink |
homogeneous |
||
|
O-52 |
atypical anemone |
6.5-8.0 |
4.5-5.2 |
white - pink |
streaked / spotted |
|
O-53 |
atypical anemone |
7.5-8.2 |
4.1-5.0 |
white - pink |
streaked / spotted |
|
O-54 |
atypical anemone |
7.4-8.0 |
4.2-5.3 |
white - pink |
streaked / spotted |
|
O-60 |
atypical anemone |
6.5-8.5 |
4.3-5.4 |
white - pink |
streaked / spotted |
|
O-61 |
atypical anemone |
8.2-9.0 |
4.1-5.3 |
white - pink |
streaked / spotted |
|
O-64 |
atypical anemone |
6.0-9.0 |
4.0-5.5 |
white - pink |
streaked / spotted |
|
PL-12 |
atypical anemone |
7.1-8.7 |
4.2-5 |
white |
homogeneous |
|
PL-23 |
atypical anemone/ full peony |
5.5-6.9 |
3.8-4.2 |
white |
streaked pink |
|
8.1-8.4 |
4.5-5.1 |
pink - white |
emarginated white |
||
|
6.8-8.4 |
4.5-4.8 |
pink – white |
dotted |
||
|
PL-35 |
atypical anemone |
9.1-9.9 |
4.1-4.9 |
white |
streaked pink |
|
8.6-10.3 |
4.6-4.8 |
pink - white |
emarginated white / diffuse towards the base pink |
||
|
PL-54 |
atypical anemone/ open peony |
7.4-8 |
4.4-4.9 |
pink |
homogeneous |
|
PL-55 |
atypical anemone |
8.4-10.2 |
4.6-4.9 |
white |
streaked pink |
|
PL- 58 |
atypical anemone/ open peony |
8.1-8.9 |
4.7-5.3 |
pink |
diffuse towards the base |
Table 5. Results of the flower, petaloid, stamens and style descriptors applied in the Camellia japonica specimens identified as 'Pomone'
| Plant code |
Petaloids | Stamens | Style | |||||
| amount | arrangement | colour | colour distribution |
amount | arrangement | colour of filaments |
presence | |
| PQL-01 | 45-120 | disordered | pink | homogenous /streaked |
2-3 | dispersed | yellow | rudimentary |
| 84-127 | white | homogenous | 8-10 | |||||
| SCR-02 | 74-138 | disordered | pink/ white |
homogenous /streaked |
22-49 | dispersed | yellow | deformed |
| 59-116 | white /pink |
streaked | 3-68 | |||||
| SCR-19 | 82-194 | disordered | pink/ white |
homogenous /streaked |
12-46 | dispersed | white | deformed |
| SCR-21 | 41-86 | disordered | pink/ white |
streaked | 8-53 | dispersed | reddish | deformed |
| O-02 | 130-140 | disordered | white | streaked | 5-10 | dispersed | white | deformed |
| O-04 | 70-90 | disordered | white | streaked | 30-50 | dispersed | white | deformed |
| O-13 | 95-132 | disordered | white | homogenous |
13-14 |
dispersed |
white |
deformed |
| 65-92 | white /pink |
streaked |
19-31 |
|||||
| 88-231 | pink/ white |
homogenous /streaked |
0-40 |
|||||
| O-15 |
52-146 |
disordered |
white /pink |
spotted/ streaked |
0-56 |
dispersed |
white- yellow |
deformed |
| 58-151 |
pink |
homogenous |
80 |
|||||
| 77-129 |
pink/ white |
emarginated |
4-18 |
|||||
| 42-113 |
white |
homogenous |
3-95 |
|||||
| O-16 |
66-140 |
disordered |
white /pink |
spotted/ streaked |
16-53 |
dispersed |
white |
deformed |
| O-20 |
80-140 |
disordered |
white /pink |
streaked /pointed |
0-6 |
dispersed |
white |
deformed |
| O-22 |
74-116 |
disordered |
white |
homogenous |
4-35 |
dispersed |
white |
deformed |
| O-23 |
90-130 |
disordered |
pink |
homogenous |
0-8 |
dispersed |
white |
deformed |
| O-25 |
88-162 |
disordered |
white |
homogenous /streaked |
0-21 |
dispersed |
white |
deformed |
| O-40 |
80-220 |
disordered |
white /pink |
streaked /pointed |
3-6 |
dispersed |
white- yellow |
deformed |
| O-41 | 60-70 | disordered | white | homogenous | 60-70 | dispersed | white- yellow |
deformed |
| O-43 | 40-57 | disordered | white /pink |
homogenous /streaked |
0-10 | dispersed | yellow | deformed |
| 41-55 | pink/ white |
homogenous /streaked |
0-9 | |||||
| O-47 | 94-150 | disordered | white /pink |
streaked /spotted |
0-35 | dispersed | white- yellow |
deformed |
| 95-140 | pink/ white |
homogenous | 0-50 | |||||
| O-51 | 60-134 | disordered | white | homogenous | 15-100 | dispersed | white | deformed |
| pink/ white |
homogenous /streaked |
10-95 | ||||||
| O-52 | 100-165 | disordered | white /pink |
streaked /pointed |
0-15 | dispersed | white- yellow |
deformed |
| O-53 | 95-165 | disordered | white /pink |
streaked /pointed |
0-15 | dispersed | white | deformed |
| O-54 | 90-140 | disordered | white /pink |
streaked /pointed |
1-5 | dispersed | white | deformed |
| O-60 | 120-150 | disordered | white /pink |
streaked /pointed |
0-3 | dispersed | white | deformed |
| O-61 | 70-155 | disordered | white /pink |
streaked /pointed |
0-5 | dispersed | white | deformed |
| O-64 | 140-195 | disordered | white /pink |
streaked /pointed |
0-18 | dispersed | white | deformed |
| PL-12 | 79-176 | disordered | white | homogenous | 52-161 | dispersed | white- yellow |
deformed |
| PL-23 | 66-104 | disordered | white | homogenous | 12-18 | dispersed | white | deformed |
| 50-89 | white | streaked | 16-29 | |||||
| 54-62 | pink | streaked | 22-33 | |||||
| PL-35 | 125-199 | disordered | white | homogenous | 102-119 | split | white- yellow |
deformed |
| 127-162 | white | streaked | 17-84 | |||||
| PL-54 | 86-106 | disordered | pink | streaked | 13-31 | dispersed | white | deformed |
| PL-55 | 76-112 | disordered | white | streaked | 37-106 | dispersed | white | deformed |
| PL-58 | 73-125 | disordered | pink | homogenous /streaked |
13-32 | dispersed | white | deformed |
Table 6. Groups obtained after applying the morphobotanic descriptors of leaf, plant and flower in the specimens of Camellia japonica identified as 'Pomone' (8 groups/cultivars were obtained).
|
G 1 |
G 2 |
G 3 |
G 4 |
G 5 |
G 6 |
G 7 |
G 8 |
|
O-20 |
O-02 |
SCR-02 |
SCR-19 |
O-23 |
O-41 |
PQL-1 |
SCR-21 |
|
O-40 |
O-04 |
O-16 |
PL-23 |
PL-58 |
PL-12 |
||
|
O-52 |
O-13 |
O-43 |
PL-35 |
||||
|
O-53 |
O-15 |
O-47 |
PL-55 |
||||
|
O-54 |
O-22 |
O-51 |
|||||
|
O-60 |
O-25 |
||||||
|
O-61 |
|||||||
|
O-64 |
|||||||
|
PL-54 |
Table 7. Groups obtained after applying the molecular markers (ISSR) in the Camellia japonica specimens identified as 'Pompone' (11 groups/cultivars were obtained)
| G1 | G2 | G3 | G4 | G5 | G6 | G7 | G8 | G9 | G10 | G11 | |
| SCR-2 | O-40 | PL-23 | PL-35 | SCR-19 | SCR-21 | O-02 | O-41 | O-23 | O-47 | O-51 | PL-12 |
| O-04 | O-43 | PL-54 | PL-55 | ||||||||
| O-13 | O-52 | PL-58 | |||||||||
| O-15 | O-53 | PQL-01 | |||||||||
| O-16 | O-54 | ||||||||||
| O-20 | O-60 | ||||||||||
| O-22 | O-61 | ||||||||||
| O-25 | O-64 | ||||||||||
Abe H., Matsuki R., Ueno S., Nashimoto M., Hasegawa M. 2006. Dispersal of Camellia japonica seeds by Apodemus speciosus revealed by maternity analysis of plants and behavioral observation of animal vectors. Ecological Research 21: 732-740.
Caser M., Torello Marinoni D., Scariot V. 2010. Microsatellite-based genetic relationships in the genus Camellia: potential for improving cultivars. Genome 53: 384-399.
Esselink G.D., Smulders M.J.M, Vosman B. 2003. Identification of cut rose (Rosa hybrida) and rootstock varieties using robust sequence tagged microsatellite site markers. Theoretical and Applied Genetics 106: 277-286.
Freeman S., West J., James C., Lea V., Mayess S. 2004. Isolation and characterization of highly polymorphic microsatellites in tea (Camellia sinensis). Molecular Ecology Notes 4: 324-326.
Hung C.Y., Wang K.H., Huang C.C., Gong X., Ge X.J., Chiang T.Y. 2008. Isolation and characterization of 11 microsatellite loci from Camellia sinensis in Taiwan using PCR-based isolation of microsatellite arrays (PIMA). Conservation Genetics 9: 779-781.
Kaundun S.S., Matsumoto S. 2002. Heterologous nuclear and chloroplast microsatellite amplification and variation in tea, Camellia sinensis. Genome 45: 1041-1048.
Kaundun S.S., Matsumoto S. 2004. PCR-based amplicon lenght polymorphisms (ALPs) at microsatellite loci and indels from non-coding DNA regions of cloned genes as a means of authenticating comercial Japanese green teas. Journal of the Science of Food and Agriculture 84: 895-902.
Mohan M., Nair S., Bhagwat A., Krishna T.G., Yano M., Bhatia C.R, Sasaki T. 1997. Genome mapping, molecular markers and marker-assisted selection in crop plants. Molecular Breeding 3: 87-103.
Ouborg N.J., Piquot Y., van Groenendael J.M. 1999. Population genetics, molecular markers and the study of dispersal plants. Journal of Ecology 87: 551-568.
Salinero C., Vela P., Couselo J.L., Sainz M.J., González M., Neves A. 2012, Characterization and identification of old Camellia japonica L. cultivars growing at the Pazo de Gandarón, Pazo de Lourizán, Soutomaior Castle and some of the urban gardens of Pontevedra and Santiago de Compostela (NW Spain). International Camellia Journal, 44: 71-76.
Savige T.J. 1993. The International Camellia Register. Ed. The International Camellia Society, Wirlinga, NSW, Australia.
Ueno S., Yoshimaru H., Tomaru N., Yamamoto S. 1999. Development and characterization of microsatellite markers in Camellia japonica L. Molecular Ecology 8: 335-346.
Vela P., Couselo J.L., Salinero C., González M., Sainz M.J. 2009. Morpho-botanic and molecular characterization of the oldest camellia trees in Europe. International Camellia Journal, 41: 51-57.
Zhao L.P., Liu Z., Chen E.L., Yao E.M.Z., Wang E.X.C. 2008. Generation and characterization of 24 novel EST derived microsatellites from tea plant (Camellia sinensis) and cross-species amplification in its closely related species and varieties. Conservation Genetics 9: 1327–1331.